Abstract

Erysipelothrix rhusiopathiae is a nonmotile, gram-positive, non-spore-forming rod found widely in nature. It is known to cause chronic or acute erysipelas in swine and erysipeloid in humans. In cetaceans the organism is capable of causing diamond back type cutaneous lesions or an acute fatal form of septicemia. Two isolates of E. rhusiopathiae, implicated in the deaths of a bottlenose dolphin (Tursiops truncatus) and a Pacific white-sided dolphin (Lagenorhynchus obliquidens) were provided to this laboratory by SPAWARSYSCEN and the John G. Shedd Aquarium, respectively. These isolates, along with nine other Erysipelothrix isolates (including two strains of E. tonsillarum), obtained from ATCC, were characterized by biochemical analysis, morphological staining techniques, and molecular analysis. Biochemical analysis included carbohydrate and hydrolytic tests, as well as tests for citrate production, motility, hydrogen sulfide production, and gelatin hydrolysis. Staining techniques employed included Gram, capsule, acid-fast, and spore stains. The molecular analysis was by the polymerase chain reaction (PCR). PCR using the primers 5=AGATGCCATAGAAACTGGTA 3= and 5= CTGTATCCGCCATAACTA 3= amplified an Erysipelothrix species specific 407 base pair DNA sequence that codes for Erysipelothrix 16s rRNA. The tests confirmed that the ATCC strains and the two isolates were Erysipelothrix species, although the Shedd isolate showed variations from the expected typical biochemical reactions for Erysipelothrix. In order to investigate whether these biochemical differences between the Shedd and SPAWARSYSCEN isolates caused any antigenic differences, Western blot experiments were performed using four types of rabbit antisera: rabbit anti-heat killed E. rhusiopathiae (for both isolates) and rabbit anti-E. rhusiopathiae membrane extracted proteins (for both isolates), prepared by the Frasch method.

Acknowledgements

This research was supported by a DEPSCoR grant through the Office of Naval Research. The E. rhusiopathiae isolates were graciously provided by Drs. William Van Bonn, SPAWARSYSCEN, and Jeff Boehm, John G. Shedd Aquarium.