Feline Immunodeficiency Virus (FIV) infection in domestic cats results in an acquired immunodeficiency syndrome (AIDS) similar to that caused by Human Immunodeficiency Virus (HIV) infection in humans. The infection stages, disease progression and therapy efficacy are monitored based on CD4+ cell counts in blood samples by use of flow cytometry. In Argentine, FIV-infected cats are treated with oral Zidovudine (AZT) and Valproic Acid because using drug cocktails enhances the therapy efficacy. The aforementioned therapy showed statistically significant differences in infected cats, with regards clinical parameters and increase of the CD4+ cells counts. FIV antiviral therapy in Argentine is limited due to the unavailability of adequate techniques to evaluate in vivo viral kinetics. We developed and optimized a qc-PCR for the quantitative detection of FIV. This method consist of the reverse transcription and amplification in the same tube of two similar RNA templates, the wild-type template and a known internally deleted synthetic template, both with identical primer recognition. In gel electrophoresis, the two targets must be clearly distinguishable to allow densitometric evaluation and further quantitation of the relative band intensities. In this work, a 594 bp fragment (wild-type template) of the highly conserved FIV gag gene was amplificated by primers FIV-771-f (AGAACCTGGTGATATACCAGAGAC) and R2-r (TCTGCTTGTTGTTCTTGAGTT) from blood samples of a naturally FIV-infected cat. The synthetic template (competitor) was constructed by deleting 100 bp from the internal sequence of wild-type template. Both templates were inserted into a plasmid vector and in vitro transcribed. The RNA concentrations were determined by measuring absorbance at 260 nm in a Gene Quant spectrophotometer. Serial dilutions of both RNA templates were submitted to qc-PCR amplification, starting at 10⁶ copies/ml and ending at 10⁹ copies/ml. We detected an analytical sensitivity of approximately 10⁶ copies/ml for 494 bp template (competitor) and 10⁸ copies/ml for 594 bp (wild-type template). The sensitivity of this technique in our hands allows us to distinguish the transition from the asymptomatic carrier stage to the AIDS stage, according to studies reported by other authors. In summary, this methodology allow determinate viral load, disease progression and therapy efficacy in advance stages of the FIV infection.